X hits on this document

PDF document

Marı´a Jose´ Casas,1* Erika Hagelberg,1 Rosa Fregel,2 Jose´ M. Larruga,2 and Ana ... - page 3 / 13

25 views

0 shares

0 downloads

0 comments

3 / 13

IMPACT OF AFRICAN MEDIEVAL MIGRATIONS IN SPAIN

541

TABLE 1. Primer pairs used for RFLP PCR amplifications of modern and historic samples, with their annealing temperature, product size, and analyzed position

Primer sequence (50 ? 30)

T (8C)

Product size (pb)

Analyzed position

50

167 þ 75 (137 þ 30 þ 75)

45

115 (100 þ 15/70 þ 30 þ 15)

52

119 (91 þ 28)

48

103 (75 þ 28)

48

275 (252 þ 23)

48

86 (64 þ 22)

48

460 þ53 (438 þ 53 þ 22)

48

103 (81 þ 22)

L 6 9 0 9 a A A G C A A T A T G A A A T G A T C T G H 7 1 1 5 a C G T A G G T T T G G T C T A G G L 6 9 7 7 b G G C C T G A C T G G C A T T G T A T T A H 7 0 5 2 b C G T A G G T T T G G T C T A G G L12238 CAAGAACTGCTAACTCATGCC T9*a TACTTTTATTTGGAGTTGCACCAAGATT L12253b ATGCCCCCATGTCTAACAAC T9*a TACTTTTATTTGGAGTTGCACCAAGATT L11486c AAAACTAGGCGGCTATGGTA H11720* AGAATAGTAATGAGGATGTAGG L11675 AGCCATTCTCATCCAAACCC H11720* AGAATAGTAATGAGGATGTAGG L10403c AAAGGATTAGACTGAACCGAA H10874* TGATTTGGTTAAAAAATAGTCG L10814 CTACCACTGACATGACTTTCCA H10874* TGATTTGGTTAAAAAATAGTCG

7025 AluI (7028) þ noH

12308 HinfI (12308) þ U/K

11718 HaeIII (11719) þ preHV, HV, H, V

10873 TaqI (10873)þ N, no L, no M

L12238, L10814, L11675, H11720*, and H10874* have been designed at La Laguna, the last two to create new restriction sites. Torroni et al., 1996. Maca-Meyer et al., 2004. Maca-Meyer et al., 2001. a b c

this one being only slightly different from that used by Wilson et al. (1995). Amplifications were done in 25 ll reactions, using 1 ll of DNA extract in 13 GeneAmp PCR Gold buffer (15 mM Tris-HCl (pH 8.0), 50 mM KCl), 2.5 mM Cl2Mg, 0.2 mM dNTPs, 0.8 mg/ml BSA, 6– 10 pmol of each primer and 0.85 U of Taq Gold Polymer- ase (Applied Biosystems). Forty amplification cycles were performed, each consisting of 1-min denaturation (948C), annealing (568C), and extension (728C) steps; the dena- turation step of the first cycle was increased to 5 min and the final extension at 728C to 10 min. One negative PCR control as well as the corresponding negative extract control were included in each amplification in order to detect possible contamination of the PCR reagents and extractions. PCR products were separated by electrophoresis in 1.5% agarose gels and visualized (Maniatis et al., 1982) with ethidium bromide staining. Positive amplifications were purified with commercial silica columns (Wizard1 SV Gel and PCR Clean-Up Sys- tem, Promega), following the manufacturer’s protocol.

ucts were loaded in 1% agarose gels, stained with ethidium bromide, and UV visualized. Positive amplifications were purified with ammonium acetate (Maniatis et al., 1982).

To solve ambiguities when ascribing sequences to hap- logroups, restriction-fragment polymorphism (RFLP) anal- ysis was designed on specific sites of the haplogroups most common in Europe and NW Africa. The analyzed positions are 7025 AluI (7028), 12308 HinfI (12308), 11718 HaeIII (11719), and 10873 TaqI (10873). PCR amplifications were done in 10–20 ll reactions and with 2 ll of template using the primers mentioned in Table 1. PCR conditions were 35 cycles, each one consisting of 15-s steps, with denatura- tion at 948C, annealing at the corresponding temperature (Table 1), and extension at 728C. Amplifications were directly digested in reactions of 15–20 ll with the corre- sponding restriction enzyme and following the manufac- turer’s recommendations. Products were loaded in 6 and 10% polyacrylamide gels, separated by electrophoresis, and detected by ethidium bromide staining.

HVRI fragments from mtDNA of the ancient samples were amplified by PCR at the laboratory at La Laguna, following the protocol described in the work of Maca- Meyer et al. (2005). We used the same primers and PCR conditions detailed by the authors, and we included two negative controls and the corresponding extraction blank control at each amplification. Products were separated by electrophoresis in 6% polyacrylamide gels and UV visualized with ethidium bromide staining. Positive amplifications were purified with ammonium acetate (Maniatis et al., 1982) and pellets were resuspended in different volumes (15–30 ll) of TE (10 mM Tris – 1 mM EDTA, pH 8.0)), depending on the PCR yield.

HVRI (632 bp) from modern samples was amplified with a pair of primers HVI(L15840) and HVII (H16436) (Gon- za´lez et al., in press) in 50 ll reactions, using 5 ll of DNA extract in 13 PCR buffer (16.6 mM (NH4)SO4 and 67 mM Tris-HCl, pH 8.8), 3 mM Cl2Mg, 0.2 mM dNTPs, 0.8 mg/ml BSA, 5 pmol of each primer, and 1 U of Taq Polymerase (Ecogen/Bioline). Thirty-five amplification cycles were per- formed, each consisting of 15-s denaturation, annealing, and extension steps at 94, 54, and 728C, respectively. One negative control was included at each amplification. Prod-

Sequencing

Both strands of the PCR fragments were sequenced, with the same pair of primers used in the corresponding amplification. Ambiguous positions were resequenced. At La Laguna, the sequencing reactions were prepared using the BigDye v3.1 Terminator Cycle Sequencing kit, (Applied Biosystems) and the products were ethanol pre- cipitated and run on an ABI PRISM 310 Genetic Ana- lyzer (Applied Biosystems). At Oslo, the sequencing reac- tions were prepared with 11 ll template, 1.1 ll primer (5 lM), and 8 ll DYEnamic ET; the products were cleaned and desalted using spin columns supplied by Amersham, Autoseq96, and then run on a MegaBACE 1000 DNA sequencing system (Amersham Pharmacia Biotech). The minimum region sequenced extended from position 15978 to 16400 and from 15841 to 16435 of the HVRI region, for the ancient and modern samples, respectively.

Contamination prevention and monitoring

To prevent contamination from modern sources, an- cient samples were prepared in a dedicated room. Surfa-

American Journal of Physical Anthropology—DOI 10.1002/ajpa

Document info
Document views25
Page views25
Page last viewedFri Oct 28 03:29:53 UTC 2016
Pages13
Paragraphs878
Words10912

Comments