X hits on this document

PDF document

José Rivera-Feliciano, Clifford J. Tabin - page 2 / 9





2 / 9

J. Rivera-Feliciano, C.J. Tabin / Developmental Biology 295 (2006) 580588


deletion of the type I receptor ALK3 in myocardium results in hypoplasia of AV cushions, thin myocardium and down- regulation of TGFβ2 (Gaussin et al., 2002). In these mutants, the AVC, albeit malformed, is patterned appropriately along the anteriorposterior axis. Recently, BMP2 protein was shown to be sufficient to induce EMT in monolayer cultures of mouse endothelium (Sugi et al., 2004). However, no molecule from the BMP subfamily, their receptors or intermediates have been implicated in the necessary upstream step of the initial establishment of the heart-valve-forming region along the anteriorposterior axis of the heart.

To circumvent Bmp2-deficient lethality and determine the role of Bmp2 in chamber specification, antero-posterior heart patterning and EC formation, we undertook a recombinase- based approach to eliminate Bmp2 specifically in the developing heart. Conditional ablation of Bmp2 in cardiac progenitors results in cell fate changes, in which the heart-valve forming region adopts the identity of differentiated chamber myocardium. Bmp2-deficient hearts fail to induce production and deposition of matrix at the heart-valve-forming region, resulting in the inability of the endothelium to swell and impairing the development of ECs. In collagen gel invasion assays, Bmp2 mutant endothelium is unable to undergo EMT, and addition of BMP2 protein to mutant heart explants rescues this process. Taken together, these results indicate that Bmp2 is both necessary and sufficient for the specification of the heart-valve-inducing region between the developing atria and ventricles.



Bmp2 floxed mice were generated in Vicki Rosen's laboratory (manuscript in preparation). Briefly, the third exon of Bmp2 and part of its 3UTR were flanked by loxP sites, whose excision creates a non-functional protein. DNAwas extracted from either tail biopsies or yolk sacs as follows: 12 mm of tail or one yolk sac was placed in a screw cap 1.5-ml tube, followed by addition of 200 l of 50 mM NaOH, incubated at 95°C for 20 min and heavily vortexed until the material disintegrates. The preparation was quick-spun to prevent cross- contamination, and then 50 l of 1 M Tris pH 8.0 was added to the mixture, mixed and spun for 5 min at maximum speed. We used 1 l of the cleared supernatant per PCR reaction with the addition of 1.5 l 25 mM MgCl2 in a 25 l reaction. Bmp2 genotyping: 5GTGTGGTCCACCGCATCAC and 5GGCAGACATTGTATCTCTAGG amplify a 474-bp product from the wild type allele and a 545-bp product from the targeted unexcised allele. Reaction conditions were 30 cycles of 30 s at 95°C, 30 s at 65°C and 60 s at 72°C, and Taq (Roche) was used as the thermo-cycling polymerase. Cre genotyping: 5GCAGAACCTGAAGATGTTCGC and 5ACACCAGAGACGGAAATC- CATC amplify a 494-bp product. Reaction conditions and DNA extractions were as above. All mice were maintained in a mixed C57BL6/129 genetic background. Bmp2wt/flox; Nkx2.5Cre+ mice were crossed with Bmp2flox/flox mice to generate Bmp2flox/flox; Nkx2.5Cre+(Bmp2Nkx2.5del) mice. Matings were timed by checking for plugs daily, with noon of the day of the plug defined as 0.5 dpc. All experiments involving mice were approved by the HMA Standing Committee on Animals.

OptiMem media (Gibco), and covered with additional collagen. The collagen sandwich was then covered with OptiMem containing 1% fetal bovine serum and penicillin/streptomycin, supplemented with insulin/transferin/selenium (all reagents from Gibco) (Camenisch et al., 2002b) and incubated in a tissue culture incubator at 37°C in 5% CO2. Where indicated, 200 ng/ml of BMP2 (a gift from Vicki Rosen) was added to the media at the start of the explant culture.


Immuno-detections were performed as described (Sugi et al., 2004), with the following modifications: the primary antibodies, monoclonal anti-α-SMA-Cy3 conjugated (Clone 1A4, Sigma) and biotin-conjugated rat anti-mouse CD31 (PECAM1) monoclonal antibody (Clone MEC 13.3, BD Pharmingen), were incubated overnight, in the dark at 4°C, followed by extensive washes in PBS. To inactivate endogenous peroxidases, we treated explants with 0.3% H2O2 for 15 min followed by a 5 min wash in TNT (0.1 M TrisHCl, pH 7.5, 0.15 M NaCl, 0.05% Tween-20). The explants were blocked for at least 1 h in TNB (0.1 M TrisHCl, pH 7.5, 0.15 M NaCl, 0.5% Blocking reagentRoche, and 10% heat inactivated sheep serum), followed by Strepavidin-POD antibody (Roche, 1:500 in TNB) incubation for 30 min, and washed three times in TNT, 5 min each, at room temperature. Tyramide amplification proceeded as per manufacturer's protocol (Molecular Probes). Fluorophore tyramide stock solution was diluted 1:100 in amplification buffer with the addition of 0.0015% H2O2. Explants were incubated in tyramide working solution for 7 min and then washed 3 times in TNT, 5 min each, at room temperature. Nuclei were counterstained with DAPI. Images were obtained using a Leica-SP2 confocal microscope.


Embryos were harvested in ice-cold PBS. Yolk sacs were kept for genotyping, while embryos were fixed in 4% PFA overnight at 4°C, followed by extensive PBS washes. Embryos were dehydrated using ethanol and embedded in paraffin, and 10-m sections were collected. Hematoxylin and eosin staining was performed using standard procedures. For Alcian Blue staining, embryos were harvested as described above. After fixation, sections were briefly washed in distilled water and then washed for 3 min in 3% acetic acid. Specimens were counterstained in a 5% acetic acid solution with Alcian Blue at 0.15 mg/ml for 2 h, after which they were washed in water, mounted in aqueous media and photographed.

In situ hybridization

Whole-mount or section in situ hybridization was performed as described (Brent et al., 2003). DIG-labeled probes were detected with NBT/BCIP (Sigma). For section in situ hybridization, mouse embryos were collected and sectioned as above. Gata4, Mlc2v (Zeisberg et al., 2005), Id1 (Benezra et al., 1990), ANF and Tbx2 (Bruneau et al., 2001) probes were synthesized as described. Notch1 was transcribed from an EST (AW047868). The Msx2 probe was a gift from Richard Mass, Harvard Medical School. An 848-bp fragment of Bmp2 was generated by RT-PCR with the primers 5AACTAGAAGCCGTGGAGGAACTTCCA and 5TTGTGGAGGGCTGCGGGTGTCGTTAG. This fragment was cloned into pGem-T-easy vector (Promega). To synthesize the antisense probe, the vector was linearized with Nde1, and transcribed using T7 polymerase.

Results and discussion

Bmp2 is required for endocardial swelling and heart-valve mesenchyme formation

Collagen gel assay for cushion mesenchyme formation

Embryos were collected in ice cold Hank's buffered saline. AV canal explants were dissected away from isolated hearts using a gastromaster microdissection tool (Xenotek Engineering). Explants were placed on top of freshly prepared 1 mg/ml type I rat-tail collagen gels (BD Biosciences) in

A cre-loxP strategy was employed in which a floxed Bmp2 allele (Bmp2flox; Rosen et al., manuscript in preparation) was deleted in cardiac progenitors by a 3UTR-ires-Cre allele of the homeobox gene Nkx2.5 (Nkx2.5Cre) (Stanley et al., 2002). We generated Bmp2flox/flox; Nkx2.5Cre+ (Bmp2Nkx2.5del)

Document info
Document views15
Page views15
Page last viewedSun Aug 07 19:54:03 UTC 2016