X hits on this document

PDF document

MicroRNA and siRNA Cloning Protocol - page 2 / 8

26 views

0 shares

0 downloads

0 comments

2 / 8

MicroRNA and siRNA Cloning Protocol

Bartel Lab Protocol Updated: July 2005

Underline nucleotides mark a Ban I restriction digest site (GGYRCC)

(available from IDT Inc. as the miRNA cloning linker) AppCTGTAGGCACCATCAddA

(RNA/DNA version, lowercase RNA) ATCGTaggcaccugaaa

: ATTGAT

(Shorter 5' end to minimize mispriming) GGTGCCTAC

ATTGAT

GGTGCCTACAG

ATCGTAGGCACCTGAAA

GTAAAACGACGGCCAG CAGGAAACAGCTATGAC

(markers should be 5' end labeled and gel-purified after labeling).

24 bp marker (synthetic sequence from an RNA ligase ribozyme; underlined bases mark an Acl-I site) GGCCAACGUUCUCAACAAUAGUGA

18 bp marker (underlined bases mark a BamH-I site) AGCGUGUAGGGAUCCAAA

32P-γ-ATP (6000 ci/mmol) T4 Polynucleotide Kinase Vertical electrophoresis unit for acrylamide gels Siliconized Tubes Aerosol Filter tips

T4 RNA Ligase Glycogen Superscript III Reverse Transcriptase Ban-I restriction enzyme Metaphor GTG Agarose

Page 2 of 8

Document info
Document views26
Page views26
Page last viewedMon Jan 23 03:05:55 UTC 2017
Pages8
Paragraphs29
Words331

Comments